Top » Catalog » SNPs » Z93

$18.00

Z93
[Z93]

Z93
hg38 Position: ChrY:7684315..7684315
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1a1a1b2
Comments: Proposed phylogeny by GregRM see http://www.box.net/shared/zc1odylvvj
Forward Primer: Z93_F CAAACAAAAATAAGAGTCACATTATGC
Reverse Primer: Z93_R CAACAATGTCAAAGAATCATGATTC
Reviews

Customers who bought this product also purchased
YSEQ-Alpha
YSEQ-Alpha
DNA Sample Kit
DNA Sample Kit
YP1548
YP1548
S23201
S23201
FGC48758
FGC48758
YP1457
YP1457
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies