Top » Catalog » SNPs » Z93

$18.00

Z93
[Z93]

Z93
hg38 Position: ChrY:7684315..7684315
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1a1a1b2
Comments: Proposed phylogeny by GregRM see http://www.box.net/shared/zc1odylvvj
Forward Primer: Z93_F CAAACAAAAATAAGAGTCACATTATGC
Reverse Primer: Z93_R CAACAATGTCAAAGAATCATGATTC
Reviews

Customers who bought this product also purchased
FT368646
FT368646
Y878
Y878
Y928
Y928
Y91066
Y91066
BY70730
BY70730
Y52775
Y52775
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies