Top » Catalog » SNPs » Z93

$18.00

Z93
[Z93]

Z93
hg38 Position: ChrY:7684315..7684315
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1a1a1b2
Comments: Proposed phylogeny by GregRM see http://www.box.net/shared/zc1odylvvj
Forward Primer: Z93_F CAAACAAAAATAAGAGTCACATTATGC
Reverse Primer: Z93_R CAACAATGTCAAAGAATCATGATTC
Reviews

Customers who bought this product also purchased
Y47
Y47
Y20746
Y20746
Y937
Y937
YP4907
YP4907
Y2632
Y2632
SUR51
SUR51
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies