Top » Catalog » SNPs » Z94

$18.00

Z94
[Z94]

Z94
hg38 Position: ChrY:18881562..18881562
Ancestral: T
Derived: C
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1a1a1b2a
Comments: Proposed phylogeny by GregRM see http://www.box.net/shared/zc1odylvvj
Forward Primer: Z94_F CTGAGCCAGCGAGACCAG
Reverse Primer: Z94_R CCCACATTTTATATTCATAGAGCAAAC
Reviews

Customers who bought this product also purchased
YP5904
YP5904
Y28816
Y28816
YP5578
YP5578
YP1412
YP1412
M417
M417
BY3301
BY3301
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies