Top » Catalog » SNPs » Z94

$18.00

Z94
[Z94]

Z94
hg38 Position: ChrY:18881562..18881562
Ancestral: T
Derived: C
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1a1a1b2a
Comments: Proposed phylogeny by GregRM see http://www.box.net/shared/zc1odylvvj
Forward Primer: Z94_F CTGAGCCAGCGAGACCAG
Reverse Primer: Z94_R CCCACATTTTATATTCATAGAGCAAAC
Reviews

Customers who bought this product also purchased
YP951
YP951
Y17619
Y17619
R1a-Z280 Panel
R1a-Z280 Panel
YP235
YP235
YP1412
YP1412
M417
M417
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies