Top » Catalog » SNPs » Z94

$18.00

Z94
[Z94]

Z94
hg38 Position: ChrY:18881562..18881562
Ancestral: T
Derived: C
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1a1a1b2a
Comments: Proposed phylogeny by GregRM see http://www.box.net/shared/zc1odylvvj
Forward Primer: Z94_F CTGAGCCAGCGAGACCAG
Reverse Primer: Z94_R CCCACATTTTATATTCATAGAGCAAAC
Reviews

Customers who bought this product also purchased
YP5322
YP5322
Z91
Z91
Y34286
Y34286
R1a Superclade Panel
R1a Superclade Panel
KMS133
KMS133
Y20787
Y20787
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies