Top » Catalog » SNPs » Z94

$18.00

Z94
[Z94]

Z94
hg38 Position: ChrY:18881562..18881562
Ancestral: T
Derived: C
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1a1a1b2a
Comments: Proposed phylogeny by GregRM see http://www.box.net/shared/zc1odylvvj
Forward Primer: Z94_F CTGAGCCAGCGAGACCAG
Reverse Primer: Z94_R CCCACATTTTATATTCATAGAGCAAAC
Reviews

Customers who bought this product also purchased
BY70730
BY70730
Y52775
Y52775
Y233278
Y233278
DC169
DC169
PH3519
PH3519
FGC10360
FGC10360
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies