Top » Catalog » SNPs » FGC18226

$18.00

FGC18226
[FGC18226]

FGC18226
hg38 Position: ChrY:17372081..17372081
Ancestral: C
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1a1a1b2a2b1
Comments: Downstream Z93 > Z94 > Z2124 > Z2122 > F1345 > Y2619 > FGC18222
Forward Primer: FGC18226_F ACAGCTATGCCTTTTACGGTG
Reverse Primer: FGC18226_R TTCAATTATGCTCTGAACCTAATGG
Reviews

Customers who bought this product also purchased
L664
L664
CTS6
CTS6
Y2395
Y2395
Y2630
Y2630
M458
M458
Z2125
Z2125
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies