Top » Catalog » SNPs » YP1506

$18.00

YP1506
[YP1506]

YP1506
hg38 Position: ChrY:9954619..9954619
Ancestral: C
Derived: T
Reference: YFull (2015)
ISOGG Haplogroup: R1a1a1b2 (not listed)
Comments: .
Forward Primer: YP1506_F GCATTGTGAAAGAGATGGTCG
Reverse Primer: YP1506_R TTGTATAGATATTTCCATGTGTATACACAAAC
Reviews

Customers who bought this product also purchased
Y56311
Y56311
Y174532
Y174532
Y43850
Y43850
Y34305
Y34305
Y33
Y33
Y41337
Y41337
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies