Top » Catalog » SNPs » YP1506

$18.00

YP1506
[YP1506]

YP1506
hg38 Position: ChrY:9954619..9954619
Ancestral: C
Derived: T
Reference: YFull (2015)
ISOGG Haplogroup: R1a1a1b2 (not listed)
Comments: .
Forward Primer: YP1506_F GCATTGTGAAAGAGATGGTCG
Reverse Primer: YP1506_R TTGTATAGATATTTCCATGTGTATACACAAAC
Reviews

Customers who bought this product also purchased
BY104501
BY104501
Y233278
Y233278
DC169
DC169
BY70730
BY70730
Y52775
Y52775
Y234930
Y234930
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies