Top » Catalog » SNPs » YP1506

$18.00

YP1506
[YP1506]

YP1506
hg38 Position: ChrY:9954619..9954619
Ancestral: C
Derived: T
Reference: YFull (2015)
ISOGG Haplogroup: R1a1a1b2 (not listed)
Comments: .
Forward Primer: YP1506_F GCATTGTGAAAGAGATGGTCG
Reverse Primer: YP1506_R TTGTATAGATATTTCCATGTGTATACACAAAC
Reviews

Customers who bought this product also purchased
FT26835
FT26835
BY30941
BY30941
FT22438
FT22438
BY60768
BY60768
Y186307
Y186307
FT119354
FT119354
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies