Top » Catalog » SNPs » YP525

$18.00

YP525
[YP525]

YP525
hg38 Position: ChrY:16604139..16604139
Ancestral: G
Derived: A
Reference: R1a community
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: YP525_F CAGTGTGAATCCCACACTGTC
Reverse Primer: YP525_R GATTCAGGAGAGCTGGTGGTC
Reviews

Customers who bought this product also purchased
F1345
F1345
Y2632
Y2632
Z2124
Z2124
Y937
Y937
YP521
YP521
R1a-Z93 Panel
R1a-Z93 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies