Top » Catalog » SNPs » YP525

$18.00

YP525
[YP525]

YP525
hg38 Position: ChrY:16604139..16604139
Ancestral: G
Derived: A
Reference: R1a community
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: YP525_F CAGTGTGAATCCCACACTGTC
Reverse Primer: YP525_R GATTCAGGAGAGCTGGTGGTC
Reviews

Customers who bought this product also purchased
CTS1806
CTS1806
F1345
F1345
Y2632
Y2632
Z2124
Z2124
Y937
Y937
YP521
YP521
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies