Top » Catalog » SNPs » FGC33208

$18.00

FGC33208
[FGC33208]

FGC33208
hg38 Position: ChrY:8659163..8659163
Ancestral: A
Derived: G
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Below S1051
Forward Primer: FGC33208v2_F GAGAAACTGCTGGGCTGC
Reverse Primer: FGC33208v2_R GTGAGGGGATCTGAGGAAAAC
Reviews

Customers who bought this product also purchased
R1b-S1051 Mid Argyll Dal Riata Panel
R1b-S1051 Mid Argyll Dal Riata Panel
FGC23333
FGC23333
FGC32881
FGC32881
FGC19433
FGC19433
FGC23338
FGC23338
FGC33210
FGC33210
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies