Top » Catalog » SNPs » FGC33208

$18.00

FGC33208
[FGC33208]

FGC33208
hg38 Position: ChrY:8659163..8659163
Ancestral: A
Derived: G
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Below S1051
Forward Primer: FGC33208v2_F GAGAAACTGCTGGGCTGC
Reverse Primer: FGC33208v2_R GTGAGGGGATCTGAGGAAAAC
Reviews

Customers who bought this product also purchased
FGC19446
FGC19446
FGC31786
FGC31786
FGC23331
FGC23331
FGC32879
FGC32879
FGC23336
FGC23336
FGC32884
FGC32884
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies