Top » Catalog » SNPs » FGC33210

$18.00

FGC33210
[FGC33210]

FGC33210
hg38 Position: ChrY:12779366..12779366
Ancestral: G
Derived: T
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Below S1051
Forward Primer: FGC33210_F ATTCCTGAGGGAGTGAGGTG
Reverse Primer: FGC33210_R CCATCTCTAAGAGGTGGCATATTC
Reviews

Customers who bought this product also purchased
FGC23330
FGC23330
FGC32878
FGC32878
FGC19428
FGC19428
FGC23335
FGC23335
FGC32883
FGC32883
FGC19435
FGC19435
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies