Top » Catalog » SNPs » FGC33211

$18.00

FGC33211
[FGC33211]

FGC33211
hg38 Position: ChrY:16620864..16620864
Ancestral: C
Derived: G
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Below S1051
Forward Primer: FGC33211_F AGGAATGCAGTGGCATGAG
Reverse Primer: FGC33211_R TTGCTGTTGTTCTCAAACACG
Reviews

Customers who bought this product also purchased
FGC19440
FGC19440
FGC31785
FGC31785
FGC33213
FGC33213
FGC23330
FGC23330
FGC32878
FGC32878
FGC19428
FGC19428
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies