Top » Catalog » SNPs » FGC33211

$18.00

FGC33211
[FGC33211]

FGC33211
hg38 Position: ChrY:16620864..16620864
Ancestral: C
Derived: G
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Below S1051
Forward Primer: FGC33211_F AGGAATGCAGTGGCATGAG
Reverse Primer: FGC33211_R TTGCTGTTGTTCTCAAACACG
Reviews

Customers who bought this product also purchased
FGC19451
FGC19451
FGC32876
FGC32876
R1b-S1051 Mid Argyll Dal Riata Panel
R1b-S1051 Mid Argyll Dal Riata Panel
FGC23333
FGC23333
FGC32881
FGC32881
FGC19433
FGC19433
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies