Top » Catalog » SNPs » FGC33211

$18.00

FGC33211
[FGC33211]

FGC33211
hg38 Position: ChrY:16620864..16620864
Ancestral: C
Derived: G
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Below S1051
Forward Primer: FGC33211_F AGGAATGCAGTGGCATGAG
Reverse Primer: FGC33211_R TTGCTGTTGTTCTCAAACACG
Reviews

Customers who bought this product also purchased
FGC32882
FGC32882
FGC19425
FGC19425
FGC23334
FGC23334
FGC23339
FGC23339
FGC33210
FGC33210
FGC19434
FGC19434
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies