Top » Catalog » SNPs » FGC33212

$18.00

FGC33212
[FGC33212]

FGC33212
hg38 Position: ChrY:20641109..20641109
Ancestral: G
Derived: A
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Below S1051
Forward Primer: FGC33212_F CAGGCAGTGGGCATAGTTG
Reverse Primer: FGC33212_R ACGAACAATCTACTTGCTTTTGC
Reviews

Customers who bought this product also purchased
FGC32885
FGC32885
FGC19432
FGC19432
FGC23337
FGC23337
FGC31786
FGC31786
FGC19446
FGC19446
FGC32879
FGC32879
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies