Top » Catalog » SNPs » FGC33213

$18.00

FGC33213
[FGC33213]

FGC33213
hg38 Position: ChrY:21331569..21331569
Ancestral: C
Derived: T
Reference: Full Genomes (2015)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Below S1051
Forward Primer: FGC33213_F GTATTTTACATTTTTCAAAGAGTCCG
Reverse Primer: FGC33213_R TAAGCCAGACAAAGTTGTTCACA
Reviews

Customers who bought this product also purchased
FGC33212
FGC33212
FGC19440
FGC19440
FGC31785
FGC31785
FGC23330
FGC23330
FGC32878
FGC32878
FGC32883
FGC32883
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies