Top » Catalog » SNPs » L1193

$18.00

L1193
[L1193]

L1193
hg38 Position: ChrY:9610875..9610875
Ancestral: C
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: I2a2a1a1a2
Comments: Found in a hg I-M223 WTY participant
Forward Primer: L1193_F TCTCCTTTTTCAGATCAGCTTCTC
Reverse Primer: L1193_R GTGTTCAGAAAATGTGACTCAACC
Reviews

Customers who bought this product also purchased
A260
A260
Y3685
Y3685
M253
M253
S2679
S2679
DF105
DF105
FGC15072
FGC15072
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies