Top » Catalog » SNPs » L1193

$18.00

L1193
[L1193]

L1193
hg38 Position: ChrY:9610875..9610875
Ancestral: C
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: I2a2a1a1a2
Comments: Found in a hg I-M223 WTY participant
Forward Primer: L1193_F TCTCCTTTTTCAGATCAGCTTCTC
Reverse Primer: L1193_R GTGTTCAGAAAATGTGACTCAACC
Reviews

Customers who bought this product also purchased
CTS616
CTS616
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
F21841
F21841
M438
M438
Z2079
Z2079
DF49
DF49
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies