Top » Catalog » SNPs » A109

$18.00

A109
[A109]

A109
hg38 Position: ChrY:19739096..19739096
Ancestral: T
Derived: C
Reference: Stewart (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1i6~
Comments: Found in 2 persons of the 1013 cluster
Forward Primer: A109_F CTGCTCTGTCTTGCCTTTCC
Reverse Primer: A109_R TCTCCCTCTACAGCCTTTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies