Top » Catalog » SNPs » Z1902

$18.00

Z1902
[Z1902]

Z1902
hg38 Position: ChrY:20661269..20661269
Ancestral: A
Derived: G
Reference: Ray Banks (2011)
ISOGG Haplogroup: E1b1b1a1a
Comments: Upstream from V12 and V65
Forward Primer: Z1902_F ATGCTAATTTGCCCTGATGG
Reverse Primer: Z1902_R GGGCAGGGCTAGTTAATAGGG
Reviews

Customers who bought this product also purchased
HU159
HU159
Wish a SNP
Wish a SNP
DYS392
DYS392
Y30984
Y30984
M78
M78
Z827
Z827
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies