Top » Catalog » SNPs » Z1902

$18.00

Z1902
[Z1902]

Z1902
hg38 Position: ChrY:20661269..20661269
Ancestral: A
Derived: G
Reference: Ray Banks (2011)
ISOGG Haplogroup: E1b1b1a1a
Comments: Upstream from V12 and V65
Forward Primer: Z1902_F ATGCTAATTTGCCCTGATGG
Reverse Primer: Z1902_R GGGCAGGGCTAGTTAATAGGG
Reviews

Customers who bought this product also purchased
Z834
Z834
CTS6178
CTS6178
L335
L335
V22
V22
M215
M215
V13
V13
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies