Top » Catalog » SNPs » Z809

$18.00

Z809
[Z809]

Z809
hg38 Position: ChrY:7403004..7403004
Ancestral: G
Derived: A
Reference: Ray Banks (2011)
ISOGG Haplogroup: E1b1b1a1a1b1
Comments: Downstream from V12 > V32
Forward Primer: Z809_F TCTTTCTGATCTTAGATGATGTCATTG
Reverse Primer: Z809_R CTCGAAGCCCCTACTTCG
Reviews

Customers who bought this product also purchased
Y15945
Y15945
V22
V22
Y28701
Y28701
Y18174
Y18174
V12
V12
V32
V32
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies