Top » Catalog » SNPs » Z809

$18.00

Z809
[Z809]

Z809
hg38 Position: ChrY:7403004..7403004
Ancestral: G
Derived: A
Reference: Ray Banks (2011)
ISOGG Haplogroup: E1b1b1a1a1b1
Comments: Downstream from V12 > V32
Forward Primer: Z809_F TCTTTCTGATCTTAGATGATGTCATTG
Reverse Primer: Z809_R CTCGAAGCCCCTACTTCG
Reviews

Customers who bought this product also purchased
M78
M78
CTS6667
CTS6667
Z814
Z814
E Superclade Panel
E Superclade Panel
CTS693
CTS693
BY8141
BY8141
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies