Top » Catalog » SNPs » Y8598

$18.00

Y8598
[Y8598]

Y8598
hg38 Position: ChrY:19440820..19440820
Ancestral: C
Derived: G
Reference: Yfull (2015)
ISOGG Haplogroup: I1 (not listed)
Comments: Approx. L258
Forward Primer: Y8598_F TGACTCAGTGATCCCATTATTCA
Reverse Primer: Y8598_R GTTCAATTCCCACCTATGGC
Reviews

Customers who bought this product also purchased
Y142122
Y142122
P109
P109
Y13391
Y13391
L287
L287
BY157356
BY157356
S335
S335
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies