Top » Catalog » SNPs » Y8598

$18.00

Y8598
[Y8598]

Y8598
hg38 Position: ChrY:19440820..19440820
Ancestral: C
Derived: G
Reference: Yfull (2015)
ISOGG Haplogroup: I1 (not listed)
Comments: Approx. L258
Forward Primer: Y8598_F TGACTCAGTGATCCCATTATTCA
Reverse Primer: Y8598_R GTTCAATTCCCACCTATGGC
Reviews

Customers who bought this product also purchased
P109
P109
BY35379
BY35379
Y51801
Y51801
L287
L287
S335
S335
I1-L22 (including P109) Panel
I1-L22 (including P109) Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies