Top » Catalog » SNPs » Y8598

$18.00

Y8598
[Y8598]

Y8598
hg38 Position: ChrY:19440820..19440820
Ancestral: C
Derived: G
Reference: Yfull (2015)
ISOGG Haplogroup: I1 (not listed)
Comments: Approx. L258
Forward Primer: Y8598_F TGACTCAGTGATCCCATTATTCA
Reverse Primer: Y8598_R GTTCAATTCCCACCTATGGC
Reviews

Customers who bought this product also purchased
CTS2208
CTS2208
BY35406
BY35406
Z133
Z133
Y13389
Y13389
CTS6868
CTS6868
Y98743
Y98743
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies