Top » Catalog » SNPs » Z367

$18.00

Z367
[Z367]

Z367
hg38 Position: ChrY:9973185..9973185
Ancestral: T
Derived: C
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a2b1a
Comments: downstream of R-L2. upstream of L20 and Z33 et al.
Forward Primer: Z367_F ACCTGGGCAATGCCAATG
Reverse Primer: Z367_R CATTTCACTAATGACCACTGATGAG
Reviews

Customers who bought this product also purchased
BY69713
BY69713
Z33
Z33
BY149308
BY149308
Wish a SNP
Wish a SNP
BY133159
BY133159
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies