Top » Catalog » SNPs » Z367

$18.00

Z367
[Z367]

Z367
hg38 Position: ChrY:9973185..9973185
Ancestral: T
Derived: C
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a2b1a
Comments: downstream of R-L2. upstream of L20 and Z33 et al.
Forward Primer: Z367_F ACCTGGGCAATGCCAATG
Reverse Primer: Z367_R CATTTCACTAATGACCACTGATGAG
Reviews

Customers who bought this product also purchased
Z12222
Z12222
Y24606
Y24606
FGC22963
FGC22963
Y20026
Y20026
S8183
S8183
FGC22968
FGC22968
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies