Top » Catalog » SNPs » Z367

$18.00

Z367
[Z367]

Z367
hg38 Position: ChrY:9973185..9973185
Ancestral: T
Derived: C
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a2b1a
Comments: downstream of R-L2. upstream of L20 and Z33 et al.
Forward Primer: Z367_F ACCTGGGCAATGCCAATG
Reverse Primer: Z367_R CATTTCACTAATGACCACTGATGAG
Reviews

Customers who bought this product also purchased
BY25318
BY25318
FT410015
FT410015
BY25320
BY25320
BY169025
BY169025
BY171286
BY171286
BY38635
BY38635
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies