Top » Catalog » SNPs » CTS8087

$18.00

CTS8087
[CTS8087]

CTS8087
hg38 Position: ChrY:15717768..15717768
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27 > Z295 > Z270 > Z279
Forward Primer: CTS8087v2_F GAAGAACATTCCATTTTCACAGG
Reverse Primer: CTS8087v2_R AAAGATCAGATAGTTTTAGGTATGTGGC
Reviews

Customers who bought this product also purchased
DF17
DF17
Y19596
Y19596
CTS4065
CTS4065
A4679
A4679
Z196
Z196
Z278
Z278
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies