Top » Catalog » SNPs » S2077

$18.00

S2077
[S2077]

S2077
hg38 Position: ChrY:12649551..12649551
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: S2077_F CAGCCACAAAAAAGAATGAGC
Reverse Primer: S2077_R ATTGTTCCAGCATCATTAGGTG
Reviews

Customers who bought this product also purchased
Z2539
Z2539
Z140
Z140
A7373
A7373
Z138
Z138
Z59
Z59
Y79974
Y79974
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies