Top » Catalog » SNPs » Z2245

$18.00

Z2245
[Z2245]

Z2245
hg38 Position: ChrY:7203193..7203193
Ancestral: C
Derived: A
Reference: Vince Tilroe (2012)
ISOGG Haplogroup: R1b1a1a2a1a2d~
Comments: approximate to or upstream of R-L238
Forward Primer: Z2245_F CATGGACTACAGGGCTCTCC
Reverse Primer: Z2245_R CACGAGTGGTTCAAGGAAGG
Reviews

Customers who bought this product also purchased
CTS11638
CTS11638
Y10827
Y10827
R1b-L238 Panel
R1b-L238 Panel
Z2248
Z2248
L238
L238
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies