Top » Catalog » SNPs » Y6651

$18.00

Y6651
[Y6651]

Y6651
hg38 Position: ChrY:21630233..21630233
Ancestral: A
Derived: G
Reference: Yfull (2014)
ISOGG Haplogroup: I2
Comments: Downstream from I-A356
Forward Primer: Y6651_F TTTTGAATGTTGCCAAGGATG
Reverse Primer: Y6651_R AACCTTGGAGACAGAGGTTGTG
Reviews

Customers who bought this product also purchased
BY170650
BY170650
A493
A493
Y16473
Y16473
A13912
A13912
A5874
A5874
A12505
A12505
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies