Top » Catalog » SNPs » YP206

$18.00

YP206
[YP206]

YP206
hg38 Position: ChrY:12953183..12953183
Ancestral: C
Derived: T
Reference: Francalacci (2013)
ISOGG Haplogroup: I2a
Comments: Downstream from I-S17250
Forward Primer: YP206_F GTGCAGTGGCACAATTTCAG
Reverse Primer: YP206_R ATGGCCTGGGTTACACAAAG
Reviews

Customers who bought this product also purchased
BY198275
BY198275
BY173304
BY173304
Z16983
Z16983
Y51673
Y51673
Y183467
Y183467
FT169314
FT169314
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies