Top » Catalog » SNPs » Z17855

$18.00

Z17855
[Z17855]

Z17855
hg38 Position: ChrY:15990617..15990617
Ancestral: G
Derived: A
Reference: Ray Banks (2015)
ISOGG Haplogroup: I2a1b2a1c
Comments: Below CTS5966 Downstream from I-CTS10228
Forward Primer: Z17855_F GAAGCTGAGTGGTTCAATGG
Reverse Primer: Z17855_R GGCATATCATACACTCCTGGTG
Reviews

Customers who bought this product also purchased
A7318
A7318
Y18331
Y18331
Z2582
Z2582
BY118217
BY118217
BY99606
BY99606
A7134
A7134
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies