Top » Catalog » SNPs » FGC4077

$18.00

FGC4077
[FGC4077]

FGC4077
hg38 Position: ChrY:4215899..4215899
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1b
Comments: .
Forward Primer: FGC4077_F AATACAATTTCAAATAAGAATAGCCTCAT
Reverse Primer: FGC4077_R GTTTTCTATTTGCATGATATATCTTACTCC
Reviews (2)

Customers who bought this product also purchased
DF21
DF21
L21
L21
A259
A259
A223
A223
L1335
L1335
Z253
Z253
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies