Top » Catalog » SNPs » FGC4077

$17.50

FGC4077
[FGC4077]

FGC4077
HG19 Position: ChrY:4083940..4083940
Ancestral: G
Derived: T
Reference:
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments:
Forward Primer: FGC4077_F AATACAATTTCAAATAAGAATAGCCTCAT
Reverse Primer: FGC4077_R GTTTTCTATTTGCATGATATATCTTACTCC
Reviews (2)

Customers who bought this product also purchased
A223
A223
L1335
L1335
Z253
Z253
DF21
DF21
L21
L21
A259
A259
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10861
1 x A10517
1 x A11227
1 x A10282
1 x A10846
1 x A1153
1 x A10514
1 x A10986
1 x A10882
1 x A11119
1 x A11520
1 x A10112
1 x A10894
1 x A10218
1 x A11679
1 x A11778
1 x A10965
1 x A10647
1 x A11656
$332.50
Haplogroup Info
Other products
Currencies