Top » Catalog » SNPs » S11348

$18.00

S11348
[S11348]

S11348
hg38 Position: ChrY:8496500..8496500
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream L25 > L70 > CTS6061 > PF5456
Forward Primer: S11348_F CATATACCTTACTTCAGCTCACAGGTAG
Reverse Primer: S11348_R CTGGGTTTAGGGATTAGACCTG
Reviews

Customers who bought this product also purchased
L70
L70
Z40776
Z40776
J2a-L24 Panel
J2a-L24 Panel
FGC21085
FGC21085
Z40772
Z40772
PH2725
PH2725
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies