Top » Catalog » SNPs » FGC33111

$18.00

FGC33111
[FGC33111]

FGC33111
hg38 Position: ChrY:11984600..11984600
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J2 (not listed)
Comments: L24(xL25)
Forward Primer: FGC33111_F AACTACTCAGGAGGCTGAGATAATAGG
Reverse Primer: FGC33111_R GTTAATAATTACAAACAGTTTAATAGAGGCAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies