Top » Catalog » SNPs » FGC8810

$18.00

FGC8810
[FGC8810]

FGC8810
hg38 Position: ChrY:16102014..16102014
Ancestral: T
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1c3d2
Comments: Downstream L222 > FGC1721
Forward Primer: FGC8810_F TTTGAGGGACTGGGGATTC
Reverse Primer: FGC8810_R AGGCAAGTTTCAAGCAGTCC
Reviews

Customers who bought this product also purchased
ZS8281
ZS8281
J1-FGC8812 Panel
J1-FGC8812 Panel
Y139885
Y139885
BY136022
BY136022
ZS3857
ZS3857
ZS9061
ZS9061
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies