Top » Catalog » SNPs » L804

$18.00

L804
[L804]

L804
hg38 Position: ChrY:11907522..11907522
Ancestral: T
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: Q1a2a1a2
Comments: Found in a hg Q-L53 WTY participant
Forward Primer: L804_F GAATTCTGTGGGTGACTTTGTG
Reverse Primer: L804_R GCACAGTGAAGAATGTGGGAC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
M3
M3
FGC6925
FGC6925
L275
L275
L56
L56
Y9291
Y9291
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies