Top » Catalog » SNPs » L804

$18.00

L804
[L804]

L804
hg38 Position: ChrY:11907522..11907522
Ancestral: T
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: Q1a2a1a2
Comments: Found in a hg Q-L53 WTY participant
Forward Primer: L804_F GAATTCTGTGGGTGACTTTGTG
Reverse Primer: L804_R GCACAGTGAAGAATGTGGGAC
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Y9291
Y9291
Q Superclade Panel
Q Superclade Panel
Y7582
Y7582
M3
M3
FGC6925
FGC6925
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies