Top » Catalog » SNPs » L804

$18.00

L804
[L804]

L804
hg38 Position: ChrY:11907522..11907522
Ancestral: T
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: Q1a2a1a2
Comments: Found in a hg Q-L53 WTY participant
Forward Primer: L804_F GAATTCTGTGGGTGACTTTGTG
Reverse Primer: L804_R GCACAGTGAAGAATGTGGGAC
Reviews

Customers who bought this product also purchased
YSEQ-Alpha
YSEQ-Alpha
L334
L334
L54
L54
M930
M930
A19001
A19001
M1107
M1107
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC30566
$18.00
Haplogroup Info
Other products
Currencies