Top » Catalog » Y SNPs » FGC6986

$18.00

FGC6986
[FGC6986]

FGC6986
hg38 Position: ChrY:19433118..19433118
Ancestral: A
Derived: G
Reference: Full Genomes Inc (2013)
ISOGG Haplogroup: Q1a2b1 (not listed)
Comments: Found in a Q-L527 person
Forward Primer: FGC6986_F GTGATTTGCCTGGCTCTCTG
Reverse Primer: FGC6986_R GTTCCCTGATGATCCCATTG
Reviews

Customers who bought this product also purchased
YP779
YP779
BZ4515
BZ4515
L275
L275
L940
L940
M1107
M1107
BZ4502
BZ4502
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies