Top » Catalog » SNPs » A5870

$18.00

A5870
[A5870]

A5870
hg38 Position: ChrY:13608636..13608636
Ancestral: A
Derived: G
Reference: Wayne Kauffman (2015)
ISOGG Haplogroup: R1b1a2a1a1c2b2b1a
Comments: Approx. S3565 equivalent
Forward Primer: A5870_F AGATTTTCCCTGAGCCTCTACTG
Reverse Primer: A5870_R ATTAACAGGGATGGGTGTGATTAC
Reviews

Customers who bought this product also purchased
CTS7411
CTS7411
A6537
A6537
S3571
S3571
A5592
A5592
Z326
Z326
S21728
S21728
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies