Top » Catalog » SNPs » A5870

$18.00

A5870
[A5870]

A5870
hg38 Position: ChrY:13608636..13608636
Ancestral: A
Derived: G
Reference: Wayne Kauffman (2015)
ISOGG Haplogroup: R1b1a2a1a1c2b2b1a
Comments: Approx. S3565 equivalent
Forward Primer: A5870_F AGATTTTCCCTGAGCCTCTACTG
Reverse Primer: A5870_R ATTAACAGGGATGGGTGTGATTAC
Reviews

Customers who bought this product also purchased
A5592
A5592
CTS7411
CTS7411
A6537
A6537
S3571
S3571
FGC18842
FGC18842
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2203
1 x A8
1 x A364
1 x A2209
1 x A1241
1 x A226
1 x A259
1 x A667
1 x A673
1 x A2240
1 x A1316
1 x A1310
1 x A178
1 x A1129
$252.00
Haplogroup Info
Other products
Currencies