Top » Catalog » SNPs » CTS4705

$18.00

CTS4705
[CTS4705]

CTS4705
HG19 Position: ChrY:15776087..15776087
Ancestral: C
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b (not listed)
Comments: Below A1067
Forward Primer: CTS4705_F ATTAAACGCCAGGGTTTGG
Reverse Primer: CTS4705_R ATACTATCCTACGGCTTGACCTTTC
Reviews

Customers who bought this product also purchased
Z192
Z192
S1051
S1051
Z56
Z56
BY2806
BY2806
Z39589
Z39589
L2
L2
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies