Top » Catalog » SNPs » CTS4705

$18.00

CTS4705
[CTS4705]

CTS4705
hg38 Position: ChrY:13664207..13664207
Ancestral: C
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b (not listed)
Comments: Below A1067
Forward Primer: CTS4705_F ATTAAACGCCAGGGTTTGG
Reverse Primer: CTS4705_R ATACTATCCTACGGCTTGACCTTTC
Reviews

Customers who bought this product also purchased
PH4078
PH4078
PF6582
PF6582
FGC36895
FGC36895
S1527
S1527
S1529
S1529
L4
L4
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies