Top » Catalog » SNPs » CTS4705

$18.00

CTS4705
[CTS4705]

CTS4705
hg38 Position: ChrY:13664207..13664207
Ancestral: C
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b (not listed)
Comments: Below A1067
Forward Primer: CTS4705_F ATTAAACGCCAGGGTTTGG
Reverse Primer: CTS4705_R ATACTATCCTACGGCTTGACCTTTC
Reviews

Customers who bought this product also purchased
BY2806
BY2806
Z39589
Z39589
L2
L2
BY3958
BY3958
DF13
DF13
R1b-U152 Superclade Panel
R1b-U152 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies