Top » Catalog » SNPs » A5890

$18.00

A5890
[A5890]

A5890
hg38 Position: ChrY:7883132..7883132
Ancestral: C
Derived: T
Reference: Jim Cooke (2015)
ISOGG Haplogroup: R1b1a1a2a1a1c2b2a1b1a4a
Comments: Below A300
Forward Primer: A5890_F GGGGTCTATAACAAAGTCACACG
Reverse Primer: A5890_R TTGCATATTTGTACAAAGCTCATG
Reviews

Customers who bought this product also purchased
S274
S274
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
Z346
Z346
S515
S515
S511
S511
Z326
Z326
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies