Top » Catalog » SNPs » A5874

$19.00

A5874
[A5874]

A5874
hg38 Position: ChrY:2868486..2868486
Ancestral: A
Derived: G
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250 > A5875
Forward Primer: A5874_F TCTGGCAAGTTGTTCTGTGG
Reverse Primer: A5874_R AAAAATCAGGTCAGGCATGG
Reviews

Customers who bought this product also purchased
A5876
A5876
Y112522
Y112522
A21278
A21278
F3145
F3145
Y32084
Y32084
A22782
A22782
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies