Top » Catalog » SNPs » A5875

$18.00

A5875
[A5875]

A5875
hg38 Position: ChrY:13305957..13305957
Ancestral: C
Derived: A
Reference: Zdenko Markovic (2015)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250 > A815
Forward Primer: A5875_F TTAATAGAGAGGGTACTTTGGTTTTC
Reverse Primer: A5875_R GCACCCACTCAACATTTCTG
Reviews

Customers who bought this product also purchased
A356
A356
A8740
A8740
A14973
A14973
A1221
A1221
Y14612
Y14612
Y103938
Y103938
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies